View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_low_57 (Length: 210)
Name: NF17625_low_57
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 8941849 - 8941680
Alignment:
| Q |
23 |
ccggtctctgccatctacatacccccggccttgaaaccgtattctgctgtgcatatggcagtgtgacagcagctgtattttgctgttgacagtcgcgcat |
122 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
8941849 |
ccggtctctgccatctacatacccctggccttgaaaccgtattctgctgtgcatatggcagtgtgacagcagctgtgttttgctgttgacagtcgtgcat |
8941750 |
T |
|
| Q |
123 |
ctgctgcttcttgttagcaaacctccaatcctcgattaaatgcttggccctcgaaactatattgcttttc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8941749 |
ctgctgcttcttgttagcaaacctccaatcctcgattaaatgcttggccctcgcaactatattgcttttc |
8941680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University