View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17625_low_58 (Length: 210)
Name: NF17625_low_58
Description: NF17625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17625_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 194
Target Start/End: Original strand, 22588456 - 22588634
Alignment:
| Q |
16 |
aatatcttagaaagcctattggtcttgaaatcatagcttagaattttggttggcattctttcacaagcaacatgaaataatggacccaagttgtaaagga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22588456 |
aatatcttagaaagcctattggtcttgaaatcatagcttagaattttggttggcattctttcacaagcaacatgaaataatggacccaagttgtaaagga |
22588555 |
T |
|
| Q |
116 |
aactagtgacttcagtggcagaggaatgatgatcttacaccagaattcctacaaattgataaaaatcggatgataaaaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22588556 |
aactagtgacttcagtggcagaggaatgatgatcttacaccagaattcctacaaattgataaaaatcggacgataaaaa |
22588634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University