View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17626_low_5 (Length: 390)
Name: NF17626_low_5
Description: NF17626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17626_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 147 - 372
Target Start/End: Original strand, 53066313 - 53066538
Alignment:
| Q |
147 |
gttagatacctggaattgttattgttgattcttggtgaagaggggcgaggagcggatgatctgaaggactgaccaccaattctgccaccagttttggcag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53066313 |
gttagatacctggaattgttattgttgattcttggtgaagaggggcgaggagcggatgatctgaaggactgaccaccaattctgccaccagttttggcag |
53066412 |
T |
|
| Q |
247 |
ctgatgcatcatgaactgatccaaacgttaacacaccagcagccactgcaatcattgctaacttccctaacttgttctcatttttcttcctattatatat |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53066413 |
ctgatgcatcatgaactgatccaaacgttaaaacaccagcagccactgcaatcattgctaacttccctaacttgttctcatttttcttcctattatatat |
53066512 |
T |
|
| Q |
347 |
acagtagttaagcagcatgcaaatat |
372 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
53066513 |
acagtagttaagcagcatgcaaatat |
53066538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University