View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17627_high_7 (Length: 405)
Name: NF17627_high_7
Description: NF17627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17627_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 22 - 280
Target Start/End: Complemental strand, 22327275 - 22327017
Alignment:
| Q |
22 |
catcatcaccaccaaacccaagaatgctttaacagttttgagcctaacccattcctctatctgtctctctctaagtctgtaccactttttgccttttttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22327275 |
catcatcaccaccaaacccaagaatgctttaacagttttgagcctaacccattcctctatctgtctctctctaagtctgtaccactttttgccttttttg |
22327176 |
T |
|
| Q |
122 |
caagttgaatgaagtgtgataccagtgttattgttgcattaattaatgaatgaaagtagaagagagcagaatgagttggttaatacccacttggagagga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22327175 |
caagttgaatgaagtgtgataccagtgttattgttgcattaattaatgaatgaaagtagaagagagcagaatgagttggttaatacccacttgtagagga |
22327076 |
T |
|
| Q |
222 |
cgagaaagaggtgtcctgttgtgaaaaatccagcaaattttccatatctcaacacacag |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22327075 |
cgagaaagaggtgtcctgttgtgaaaaatccagcaaattttccatatctcaacacacag |
22327017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 312 - 384
Target Start/End: Complemental strand, 22326985 - 22326913
Alignment:
| Q |
312 |
taacagtaaattaagggtatagggaagaggaattcattctggccctataagaaagaggcttttgatgatgatg |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22326985 |
taacagtaaattaagggtatagggaagaggaattcattctggccctataagaaagaggcttttgatgatgatg |
22326913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University