View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17627_low_5 (Length: 290)
Name: NF17627_low_5
Description: NF17627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17627_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 8 - 274
Target Start/End: Original strand, 11526065 - 11526331
Alignment:
| Q |
8 |
agaaatgaaatggaccaaattaatctggaacaaagatattcctccatcaaagtctttgatgattaggcgattgatgcaagagaaaatccccggtgataaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11526065 |
agaaatgaaatggaccaaattaatctggaacaaagatattcctccatcaaagtctttgatgattaggcgattgatgcaagagaaaatccccagtgataaa |
11526164 |
T |
|
| Q |
108 |
aggttaatggaaagaggctgtcagtttgcttctatgtgcagcctttgtttcaagagttcagaatcttccttacatttattcttttcctgctcttatgctc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
11526165 |
aggttaatggaaagaggctgtcagtttgcttctatgtgcagcctttgtttcaagagttcagaatcttccttacatttatttttttcctgctcctatgctc |
11526264 |
T |
|
| Q |
208 |
agaaactttggtcttggatttctgccactttaaacatcaacatacagtttggttcaatggatgatat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11526265 |
agaaactttggtcttggatttctgccactttaaacatcaacatacagtttggttcaatggatgatat |
11526331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University