View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17628_high_4 (Length: 390)

Name: NF17628_high_4
Description: NF17628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17628_high_4
NF17628_high_4
[»] chr5 (3 HSPs)
chr5 (20-161)||(3452603-3452744)
chr5 (261-384)||(3452844-3452967)
chr5 (19-161)||(3462624-3462763)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 5e-72; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 20 - 161
Target Start/End: Original strand, 3452603 - 3452744
Alignment:
20 agctgagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatggcttgaactgtgtcga 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
3452603 agctgagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatcgcttgaactgtgtcga 3452702  T
120 tgtatgagtttgttgctctctctggggaccatactagtttca 161  Q
    ||||||||||||||||||||||||||||||||||||||||||    
3452703 tgtatgagtttgttgctctctctggggaccatactagtttca 3452744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 261 - 384
Target Start/End: Original strand, 3452844 - 3452967
Alignment:
261 ggaagaaatgggtgtagagggttatatttatgggtgttaagggacaaaacatttgacttttcgtctttgggctatgtttcgtaacgtattggattacgat 360  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3452844 ggaagaaatgggtgtagtgggttatatttatgggtgttaagggacaaaacatttgacttttcgtctttgggctatgtttcgtaacgtattggattacgat 3452943  T
361 agcaagttgcactgttcatctcac 384  Q
    ||||||||||||||||| ||||||    
3452944 agcaagttgcactgttcttctcac 3452967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 3462624 - 3462763
Alignment:
19 aagctgagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatggcttgaactgtgtcg 118  Q
    ||||||||||||||||||||| |||||||  || || | ||||||| |||| ||||| ||   ||||||||||   ||||||| |||||||||||||||     
3462624 aagctgagcgttccatcctgccgccatagctgaaacaaactccgccacaccagattcactgacaaggtgattg---gtggttacggcttgaactgtgtct 3462720  T
119 atgtatgagtttgttgctctctctggggaccatactagtttca 161  Q
    ||||||||||| |||||||||||||||||||| || |||||||    
3462721 atgtatgagttagttgctctctctggggaccaaacaagtttca 3462763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University