View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17628_high_7 (Length: 353)
Name: NF17628_high_7
Description: NF17628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17628_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 5797272 - 5797035
Alignment:
| Q |
19 |
attttcatatcatattcatatcaaacatattttcacgttaatgtgaaagttgcatgagtcattgannnnnnnggattgaaaacacattttgttttggtca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5797272 |
attttcatatcatattcatatcaaacatattttcacgttaatgtgaaagttgcatgagtcattgatttttttggattgaaaacacattttgttttggtca |
5797173 |
T |
 |
| Q |
119 |
taggtgtttaatgtgaaaactatatcttaatgacataaattaaatatgattttgaatatgtttgaccaatgttaaattactttatttaattttccatttt |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5797172 |
taggagtttaatgtgaaaactatatcttaatgacataaattaaatatgattttgaatatgtttgaccaatgttaaattactttatttaattttccatttt |
5797073 |
T |
 |
| Q |
219 |
ctcttctctcatacaataatataagtatgtaagaacta |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5797072 |
ttcttctctcatacaataatataagtatgtaagaacta |
5797035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 309 - 353
Target Start/End: Complemental strand, 5796982 - 5796938
Alignment:
| Q |
309 |
caaaaccttcacttcgcagctttttcaatctgctttctttgactc |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5796982 |
caaaaccttcacttcgcagctttttcaatctgctttctttgactc |
5796938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University