View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17628_low_18 (Length: 230)
Name: NF17628_low_18
Description: NF17628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17628_low_18 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 27920 - 28125
Alignment:
| Q |
1 |
caaacgctatcatcgtcattacagctagcaaagtttccacaagcattatatgttaaacatttgcttcttggctgcttccatataactggcaaatcatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27920 |
caaacgctatcatcgtcattacagctagcaaagtttccacaagcattatatgttaaacatttgcttcttggctgcttccatataactagcaaatcatctt |
28019 |
T |
 |
| Q |
101 |
ccacccactgtatcacacctgtggaattgaggaacaatcttttattgttatactgtttgttacgaattactgacctgttccgtttttcaggtgaactgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28020 |
ccacccactgtatcacacctgtggaattgaggaacaatcttttattgttatactgttcgttacgaattactgatctgttccgtttttcaggtgaactgaa |
28119 |
T |
 |
| Q |
201 |
tttgtt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
28120 |
tttgtt |
28125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University