View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17628_low_4 (Length: 390)
Name: NF17628_low_4
Description: NF17628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17628_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 5e-72; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 20 - 161
Target Start/End: Original strand, 3452603 - 3452744
Alignment:
| Q |
20 |
agctgagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatggcttgaactgtgtcga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3452603 |
agctgagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatcgcttgaactgtgtcga |
3452702 |
T |
|
| Q |
120 |
tgtatgagtttgttgctctctctggggaccatactagtttca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452703 |
tgtatgagtttgttgctctctctggggaccatactagtttca |
3452744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 261 - 384
Target Start/End: Original strand, 3452844 - 3452967
Alignment:
| Q |
261 |
ggaagaaatgggtgtagagggttatatttatgggtgttaagggacaaaacatttgacttttcgtctttgggctatgtttcgtaacgtattggattacgat |
360 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452844 |
ggaagaaatgggtgtagtgggttatatttatgggtgttaagggacaaaacatttgacttttcgtctttgggctatgtttcgtaacgtattggattacgat |
3452943 |
T |
|
| Q |
361 |
agcaagttgcactgttcatctcac |
384 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
3452944 |
agcaagttgcactgttcttctcac |
3452967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 3462624 - 3462763
Alignment:
| Q |
19 |
aagctgagcgttccatcctgctgccatagaggataccagctccgccgcaccggattcgctagaaaggtgattgatggtggttatggcttgaactgtgtcg |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||| || || | ||||||| |||| ||||| || |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
3462624 |
aagctgagcgttccatcctgccgccatagctgaaacaaactccgccacaccagattcactgacaaggtgattg---gtggttacggcttgaactgtgtct |
3462720 |
T |
|
| Q |
119 |
atgtatgagtttgttgctctctctggggaccatactagtttca |
161 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||| |
|
|
| T |
3462721 |
atgtatgagttagttgctctctctggggaccaaacaagtttca |
3462763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University