View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17629_high_18 (Length: 247)
Name: NF17629_high_18
Description: NF17629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17629_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 21 - 180
Target Start/End: Complemental strand, 28721578 - 28721419
Alignment:
| Q |
21 |
ttgagaattttaaaactacttaaaatgaaatgttgtttttattagtttctnnnnnnnccatttttgataacttattgtttaaaagaatgatttcattcta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28721578 |
ttgagaattttaaaactacttaaaatgaaatgttgtttttattagtttctaaaaaaaccatttttgataacttaatgtttaaaagaatgatttcattcta |
28721479 |
T |
|
| Q |
121 |
gtaaacaaacacaattttttgtttacccttctttaaaatctctgaaaattaatccctaaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28721478 |
gtaaacaaacacaattttttgtttacccttctttaaaatctctgaaaattaatccctaaa |
28721419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University