View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17629_low_14 (Length: 284)
Name: NF17629_low_14
Description: NF17629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17629_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 42843724 - 42843452
Alignment:
| Q |
1 |
ttgaaatgaaaatatataaattattttcatttaccatggaacgtctcttgcatgtggagttttttccacaatcatt--gtgtccaagcagtttccccatt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
42843724 |
ttgaaatgaaaatatataaattattttcatttaccatggaacgtctcttgcatgtggagttttttccacaatcattttgtgtccaagcagtttcaccatt |
42843625 |
T |
|
| Q |
99 |
accatcaaaaacacctttacctgataaggtaaaatagtcaacatatccaaatttaacccattaataag---catcattaagctcatcagggttttgtggt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
42843624 |
accatcaaaaacacctttacctgataaggtaaaatagtcaacatatccaaatttaacccattgataagaagcatcattaagctcatcagggttttgtgag |
42843525 |
T |
|
| Q |
196 |
gcttgaattgtgccatcaacttgaacttcaatgggagccttacaaggaccttttacatctacagcatgcatct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42843524 |
gcttgaattgtgccatcaacttgaacttcaatgggagccttacaaggaccttttacatctacagcatgtatct |
42843452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 24243858 - 24243913
Alignment:
| Q |
193 |
ggtgcttgaattgtgccatcaacttgaacttcaatgggagccttacaaggaccttt |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
24243858 |
ggtgcttgaattgttccatcaacttgaagttcaataggagccttacaaggaccttt |
24243913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 24298340 - 24298285
Alignment:
| Q |
193 |
ggtgcttgaattgtgccatcaacttgaacttcaatgggagccttacaaggaccttt |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
24298340 |
ggtgcttgaattgttccatcaacttgaagttcaataggagccttacaaggaccttt |
24298285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 196 - 248
Target Start/End: Original strand, 24232150 - 24232202
Alignment:
| Q |
196 |
gcttgaattgtgccatcaacttgaacttcaatgggagccttacaaggaccttt |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
24232150 |
gcttgaattgttccatcaacttgaacttcaataggtgccttacaaggaccttt |
24232202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University