View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17629_low_15 (Length: 277)
Name: NF17629_low_15
Description: NF17629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17629_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 39531185 - 39531438
Alignment:
| Q |
9 |
gattattcttgttgttgacaggatatcctgtggtagttggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggat |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39531185 |
gattcttcttgttgttgacaggatatcctgtagtagttggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggat |
39531284 |
T |
 |
| Q |
109 |
tgggaaaagtgaagcatttgctatgaatatgttggataaaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39531285 |
tgggaaaagtgaagcatttgctatgaatatgttggataaaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatac |
39531384 |
T |
 |
| Q |
209 |
ttaatttgtgatgatttttgcaatatggattgtggtgtgtgatgaagtcattat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39531385 |
ttaatttgtgatgatttttgcaatatggattgtggtgtgtgatgaagtcattat |
39531438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University