View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17629_low_18 (Length: 252)
Name: NF17629_low_18
Description: NF17629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17629_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 33 - 231
Target Start/End: Complemental strand, 1804230 - 1804032
Alignment:
| Q |
33 |
tttaaataatagcattatatctgaattgatattgaaaactgcatattttaaatataaagaaacttttaacactcaaacaggtagtcatttatcctttcaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1804230 |
tttaaataatagcattatatctgaattgatattgaaaactgcatattttaaatataaagaaacttttaacactcaaacaggtagtcatttatcctttcaa |
1804131 |
T |
 |
| Q |
133 |
agtcacaactgtgaaaagctaccaagcataagatgtcaaggattattatgtacagaatagcatgcgagtaatatgtcatatgtgaatacatcaaaccat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1804130 |
agtcacaactgtgaaaagctaccaagcataagatgtcaaggattattatgtacagaatagcatgcgagtaatatgtcatatgtgaatacatcaaaccat |
1804032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University