View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17629_low_2 (Length: 408)
Name: NF17629_low_2
Description: NF17629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17629_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 133 - 393
Target Start/End: Original strand, 19506158 - 19506418
Alignment:
| Q |
133 |
cttgagaaatgaatttgattcttgatccaaattccttaggcagaagagaatggaacaaaatgtggaacaggcttgcacttcaatggtttagccaaaaaca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506158 |
cttgagaaatgaatttgattcttgatccaaattccttaggcagaagagaatggaacaaaatgtggaacaggcttgcacttcaatggtttagccaaaaaca |
19506257 |
T |
|
| Q |
233 |
cagtaacccttcctacttcagacatatcaatatcatgactcttaccatcattaacaacccaatcaaagcattgtatcaaacttgcaagtgttgcttgtat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506258 |
cagtaacccttcctacttcagacatatcaatatcatgactcttaccatcattaacaacccaatcaaagcattgtatcaaacttgcaagtgttgcttgtat |
19506357 |
T |
|
| Q |
333 |
aacaagcaaagcaagtgaagaaccagggcaacttcttctcccactaccaaatggtaaaagt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506358 |
aacaagcaaagcaagtgaagaaccagggcaacttcttctcccactaccaaatggtaaaagt |
19506418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 19506039 - 19506103
Alignment:
| Q |
14 |
agagaagaattggattacctaatcacttatttttatcctgccaagaagttttcacatacacttcc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506039 |
agagaagaattggattacctaatcacttatttttatcctgccaagaagttttcacatacacttcc |
19506103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University