View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17629_low_22 (Length: 239)
Name: NF17629_low_22
Description: NF17629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17629_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 13918932 - 13919160
Alignment:
| Q |
1 |
tattaaaacaagggtgatgaacatgaaagtggaggctggaaaggaaccaccttatgctggtgctttggattgtgctttgaaaacagttcgtgctgagggt |
100 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13918932 |
tattaagacaagggtgatgaacatgaaggtggaggctggaaaggaaccaccctatgctggtgctttggattgtgctttgaagacagttcgtgctgagggt |
13919031 |
T |
|
| Q |
101 |
cctctggctctatacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgttactttggagcaagttcgcaagttgttga |
200 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919032 |
cctatggctctttacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgttactttggagcaagttcgcaagttgttga |
13919131 |
T |
|
| Q |
201 |
aggatttctgagttgctagattgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13919132 |
aggatttctgagttgctagattgatgatg |
13919160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 2 - 209
Target Start/End: Original strand, 28830175 - 28830382
Alignment:
| Q |
2 |
attaaaacaagggtgatgaacatgaaagtggaggctggaaaggaaccaccttatgctggtgctttggattgtgctttgaaaacagttcgtgctgagggtc |
101 |
Q |
| |
|
||||| || ||||||||||| ||||| |||||||||||| | |||||||| | ||||| | |||||||||||||| || ||||||||||||||| |
|
|
| T |
28830175 |
attaagactagggtgatgaatatgaaggtggaggctggatcgcctccaccttactccggtgccattgattgtgctttgaagactattcgtgctgagggtc |
28830274 |
T |
|
| Q |
102 |
ctctggctctatacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgttactttggagcaagttcgcaagttgttgaa |
201 |
Q |
| |
|
|| ||||||| || ||||| ||||||||||||||| ||||||||||||| || || ||||| |||||||||| ||||| || ||||| |||||| | || |
|
|
| T |
28830275 |
ctatggctctttataagggttttattcctacaattacaaggcagggaccgtttaccgttgtgttgtttgttacattggaacaggttcgtaagttgcttaa |
28830374 |
T |
|
| Q |
202 |
ggatttct |
209 |
Q |
| |
|
|||||||| |
|
|
| T |
28830375 |
ggatttct |
28830382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 171
Target Start/End: Original strand, 46255127 - 46255193
Alignment:
| Q |
105 |
tggctctatacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgt |
171 |
Q |
| |
|
||||||| || ||||| |||||||||||||||||||| ||||| ||||| ||||||||||| ||||| |
|
|
| T |
46255127 |
tggctctttataagggttttattcctacaatttcaagacagggtccttttactgttgttctttttgt |
46255193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University