View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1762_high_15 (Length: 275)
Name: NF1762_high_15
Description: NF1762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1762_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 258
Target Start/End: Complemental strand, 5875605 - 5875356
Alignment:
| Q |
10 |
attatacttaaatgaatctcgcttgttgtaatgtccccactcaacacaagtatnnnnnnnn-cactttttaaatcaaatgaaaatggctttttaaatcgg |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5875605 |
attatacttaaatgaacctcgcttgttgtaatgtccccactcaacacaagtataaaaaaaaacactttttaaatcatatgaaaatggctttttaaatcgg |
5875506 |
T |
 |
| Q |
109 |
tcatgtatcgcctactcggatttcgaggattaaatcgcggaatgttatttgaagagtttgtcgagattgtttgtctacgcgaaagaagttgcaagagagg |
208 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
5875505 |
tcatgtatcgtctactcggatttggaggattaaatcgcggaatcttatttgaagagtttgtcgagattgtttgtatatgcgaaagaagttgcaagagagg |
5875406 |
T |
 |
| Q |
209 |
ggtgctaactgtcctggtagctgccctgtttgtgacaatagtgtcgaaca |
258 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5875405 |
ggtgctaactgtcctagtagctgccctgtttgtgacaatagtgtcgaaca |
5875356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 109
Target Start/End: Original strand, 18111195 - 18111233
Alignment:
| Q |
71 |
cactttttaaatcaaatgaaaatggctttttaaatcggt |
109 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18111195 |
cactttttaaatcagatgaaaatgactttttaaatcggt |
18111233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University