View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1762_low_10 (Length: 342)
Name: NF1762_low_10
Description: NF1762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1762_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 8 - 326
Target Start/End: Complemental strand, 1821266 - 1820959
Alignment:
| Q |
8 |
agattatactagaaacggaaatatagaacaaaacaatctgtacagacaatcaggttaatgatttaatccacaccatcttcaattttgttttcctttcttt |
107 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1821266 |
agattacacaagaaacggaaatatagaacaaaacaatctgtacacacaatcaggttaatgatttaatccacaccatcttcaatttt----------cttt |
1821177 |
T |
|
| Q |
108 |
gccttcagtcttccatcatattcacatcagaaaagttgtctttgcattccaacttttgaaggatcaacctttcttgctttgcatctgttgtactgtgtag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1821176 |
gccttcagtcttccatcatattcacatcagaaaagttgtctttgcattccaacttttgaaggatcaacctttcttgctttgcatctgttgtactgtgtag |
1821077 |
T |
|
| Q |
208 |
taaagaaacttatcgaagcaaatcaaaatgttgtagtaagtgcaaaatgaatggtggttcacaagcattgataatatctaagactcatctctactccccc |
307 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
1821076 |
taaagaaacttaccgaagcaaatcaaaatgttgtagtaagtgcaaaatgaatggtggttcacaagcattgataatatctaagactcatctctact-cctc |
1820978 |
T |
|
| Q |
308 |
cttcttctcaactggagat |
326 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1820977 |
cttcttctcaactggagat |
1820959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University