View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1762_low_17 (Length: 268)
Name: NF1762_low_17
Description: NF1762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1762_low_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 268
Target Start/End: Complemental strand, 6171541 - 6171288
Alignment:
| Q |
16 |
gttaattcaagtacaatttgttgaacaaaggtacaaggaacacaacttgcgttattaattagaaatattgaactttatgcattagacaacataattagta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6171541 |
gttaattcaagtacaatttgttgaacaaaggtacaaggaacacaacttgcgacattaattagaaatattgaactttatgcattagacaacataattagta |
6171442 |
T |
 |
| Q |
116 |
gtatattattgtgagatttaaggaatatggaaaactaattaaaattcattatttcgtcatatcatctcacttttataagtcacatatttgatcaaatatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6171441 |
gtatattattgtgagatttaaggaatatggaaaactaattaaaattcattatttcgtcatatcatctcacttttataagtcacatatttgatcaaatatt |
6171342 |
T |
 |
| Q |
216 |
tgtaattgttcatttgcctttatcc-tacaaaaaatactgtaaaattgatttac |
268 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
6171341 |
tgtaattgttcatttgcctttatccaaaaaaaaaatactgtaaaattgatttac |
6171288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University