View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1762_low_32 (Length: 226)
Name: NF1762_low_32
Description: NF1762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1762_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 37221050 - 37220843
Alignment:
| Q |
1 |
agataagaatttgggtgtcttgaatatgtaaattggtgttagcaattatgcatgctatatggaaaatggaaataggattttgagaaagacatctaaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37221050 |
agataagaatttgggtgtcttgaatatgtaaactggtgttagcaattatgcatgctatatggaaaatggaaataggattttgagaaagacatctaaatct |
37220951 |
T |
 |
| Q |
101 |
tccagttgtgagatatgaacattccaattataactcttaataatattaatattaaaattcatacaaaccaatcaactattannnnnnngtttaagtcaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37220950 |
tccagttgtgagatatgaacattccaattataactcttattaatattaatattaaaattcatacaaaccaatcaactattatttttttgtttaagtcaaa |
37220851 |
T |
 |
| Q |
201 |
tgtaagga |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
37220850 |
tgtaagga |
37220843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University