View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17631_high_2 (Length: 391)
Name: NF17631_high_2
Description: NF17631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17631_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 372
Target Start/End: Complemental strand, 43775729 - 43775364
Alignment:
| Q |
8 |
gacatcatcaaaatctacggcatcacatcacggagctatgaaa-ggataaatttgcaatagtacgttatatttggctgttgaatgatgcttgggttgcat |
106 |
Q |
| |
|
|||||||| | ||||||| |||||||||||| ||||||||| ||||||||||| |||||| | |||||||| ||| | | |||||||||||||||| |
|
|
| T |
43775729 |
gacatcattagaatctactacatcacatcacgatgctatgaaatggataaatttgtaatagtgcattatattttgctctgcagggatgcttgggttgcat |
43775630 |
T |
|
| Q |
107 |
aacactgacattttcatctaaaaatatatctatttggaaaccaatgccgaatctcaaacaaacaaaattttcatttagaaaactaccaagcatatcattg |
206 |
Q |
| |
|
| |||| ||||||| |||||| |||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||| ||| || ||||| |||| |
|
|
| T |
43775629 |
gatactggcattttcgtctaaagatatatctgtttgaaaaccaatgccaaatctcaaacaaacaaaattttcatttagaaaattactaatcatataattg |
43775530 |
T |
|
| Q |
207 |
ttaacttaagtaaatttagaagacaaaagatgcagggaactcacatactgcgttgcaatacaatgtcatgcatgctaaacacttacaaggatgatttttg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43775529 |
ttaacttaagtaaatttagaagacaaaagatgcagggaacccatatgctgcgttgcaatacaatgccatgcatgctaaacacttacaaggatgatttttg |
43775430 |
T |
|
| Q |
307 |
tttcgtccaactccctctagattttcaacaacttatcagcctctgcagggtcctggagatttgaca |
372 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43775429 |
tttcgtccaactccctctggattttcaacaacttatcagcctctgcagggtcctggagatttgaca |
43775364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University