View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17631_high_7 (Length: 245)
Name: NF17631_high_7
Description: NF17631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17631_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 3181095 - 3181306
Alignment:
| Q |
16 |
attcacagtaatctcttacccactccactcgcccaatttcaactcaattttcaccgataatgccaccgaataccagtattctcccattaatcgtaactat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3181095 |
attcacagtaatctcttacccactccactctcccaatttcaactcaattttcaccgataatgccaccgaataccagtattctcccattaatcgtaactat |
3181194 |
T |
|
| Q |
116 |
tacgatcgcctcgttgcttcttgcgacggtataatttgtttcgcaatcaatcctaatctagctcttctttggaacccttccatgagaatattgaagcaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3181195 |
tacgatcgcctcgttgcttcttgcgacggtataatttgtttcgcaatcaatcctaatctagctcttctttggaacccttccatgagaatattgaagcaat |
3181294 |
T |
|
| Q |
216 |
tacccgctttag |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3181295 |
tacccgctttag |
3181306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 227
Target Start/End: Complemental strand, 23896722 - 23896614
Alignment:
| Q |
119 |
gatcgcctcgttgcttcttgcgacggtataatttgtttcgcaatcaatcctaatctagctcttctttggaacccttccatgagaatattgaagcaattac |
218 |
Q |
| |
|
||||| ||| ||||||||||||||||| | |||||||| ||||| || || |||| || || ||||||||||||||| |||| ||| ||| |||||| |
|
|
| T |
23896722 |
gatcgactcattgcttcttgcgacggtctcatttgttttgcaattgatactcatcttgccgttacttggaacccttccattagaaaattaaagaaattac |
23896623 |
T |
|
| Q |
219 |
ccgctttag |
227 |
Q |
| |
|
|| |||||| |
|
|
| T |
23896622 |
ccactttag |
23896614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University