View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17631_low_4 (Length: 374)
Name: NF17631_low_4
Description: NF17631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17631_low_4 |
 |  |
|
| [»] scaffold0094 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 308
Target Start/End: Complemental strand, 13695925 - 13695638
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggcaaactagaggtaagggg-gagtctatcttcaccacaagggctgcatgaacatatgggtactactgaagggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||| | ||||||| |
|
|
| T |
13695925 |
attcaaccgtagaaattcatcaattcggcaaactagaggtaaggggagagtctatcttcaccacaagggatgcatgaacatatcggtagt---gaagggt |
13695829 |
T |
 |
| Q |
118 |
gttgtttcttattatttatcatgattcttttcataaattcatgttgtgattttggatatattattgtgaattcattactttcatctgctaaattcatgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
13695828 |
gttgtttcttattatttatcatgattcttttcataaattcatgttgtgattttggatatattattgtgaattcattactttcatatgctaaatttatgat |
13695729 |
T |
 |
| Q |
218 |
tgaaatttagtttctaattatgtgttaagaacgattgctgtatatatgatgctctcgtaaaccgttatgaaactccatgctttcttttggt |
308 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13695728 |
tgaaatatagtttctaattatgtgttaagaacgattgctgtatatatgatgctctcgtaaaccgttatgaaactccatgccttcttttggt |
13695638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 19 - 156
Target Start/End: Complemental strand, 13696133 - 13695998
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggcaaactagaggtaagggg-gagtctatcttcaccacaagggctgcatgaacatatgggtactactgaagggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||| |||||||||||||||||| | ||||||| |
|
|
| T |
13696133 |
attcaaccgtagaaattcatcaattcggcaaactagagggaaggggagagtctatcttcatcacaagggatgcatgaacatatgggtagt---gaagggt |
13696037 |
T |
 |
| Q |
118 |
gttgtttcttattatttatcatgattcttttcataaatt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13696036 |
gttgtttcttattatttatcatgattcttttcataaatt |
13695998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 3312710 - 3312659
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggcaaactagaggtaagggggagtct |
70 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3312710 |
attcaaccgtaggaagtcatcaattcggcaaactagagataagggggagtct |
3312659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 3311009 - 3310958
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggcaaactagaggtaagggggagtct |
70 |
Q |
| |
|
||||||| |||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3311009 |
attcaacagtaggaagtcatcaattcgacaaactagaggtaagggggagtct |
3310958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 48327 - 48239
Alignment:
| Q |
18 |
aattcaaccgtagaaattcatcaattcggcaaactagaggtaag-ggggagtctatcttcaccacaagggctgcatgaacatatgggta |
105 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||| ||||||||| | ||||||| |||| || |||| |||||||||| |
|
|
| T |
48327 |
aattcaaccgtaggaattcatcaattcggaaaactagaggtaaggggggagtctctattcaccataaggattgtatgatcatatgggta |
48239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 19566901 - 19566990
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggc-aaactagaggtaa--gggggagtctatcttcaccacaagggctgcatgaacatatgggta |
105 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||||||| || |||||||||| | ||||||| ||||| || |||||||||||||| |
|
|
| T |
19566901 |
attcaaccgtagaaattcatctattcagcaaaactagaggcaagggggggagtctgtattcaccataagggttgtgtgaacatatgggta |
19566990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 18534442 - 18534526
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggcaaa-ctagaggtaagggggagtctatcttcaccacaagggctgcatgaacatatgg |
102 |
Q |
| |
|
|||||||| ||| || ||||||||| ||||| |||||||||||||||||||| | ||||||| |||| || |||||||||||| |
|
|
| T |
18534442 |
attcaaccataggaaatcatcaatttcgcaaaactagaggtaagggggagtctctattcaccataaggattgtatgaacatatgg |
18534526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 25 - 64
Target Start/End: Complemental strand, 3593138 - 3593099
Alignment:
| Q |
25 |
ccgtagaaattcatcaattcggcaaactagaggtaagggg |
64 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3593138 |
ccgtaggaaatcatcaattcggcaaactagaggtaagggg |
3593099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 47 - 105
Target Start/End: Original strand, 30993287 - 30993346
Alignment:
| Q |
47 |
caaactagaggtaaggggg-agtctatcttcaccacaagggctgcatgaacatatgggta |
105 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||| ||||| || ||||||||||||||| |
|
|
| T |
30993287 |
caaactagaggtaaggggggagtctctattcaccataagggttgtatgaacatatgggta |
30993346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 35 - 70
Target Start/End: Original strand, 171485 - 171520
Alignment:
| Q |
35 |
tcatcaattcggcaaactagaggtaagggggagtct |
70 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
171485 |
tcatcaattcggaaaactagaggtaagggggagtct |
171520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 35 - 70
Target Start/End: Complemental strand, 14645805 - 14645770
Alignment:
| Q |
35 |
tcatcaattcggcaaactagaggtaagggggagtct |
70 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14645805 |
tcatcaattcggaaaactagaggtaagggggagtct |
14645770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 15266936 - 15266978
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggcaaactagaggtaag |
61 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
15266936 |
attcaacggtaggaattcatcaattcgacaaactagaggtaag |
15266978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 103
Target Start/End: Complemental strand, 16093588 - 16093511
Alignment:
| Q |
27 |
gtagaaattcatcaattcggcaaactagaggtaag-ggggagtctatcttcaccacaagggctgcatgaacatatggg |
103 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| ||||||||| | ||||||| ||||| || || | |||||||| |
|
|
| T |
16093588 |
gtagaaattcatcacttttgcaaactagaggtaagaggggagtctctattcaccataagggttgtataatcatatggg |
16093511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 105
Target Start/End: Original strand, 39436009 - 39436065
Alignment:
| Q |
48 |
aaactagaggtaagggggagtctatcttcaccacaagggctgcatgaacatatgggta |
105 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| || | ||| ||||||||||||||| |
|
|
| T |
39436009 |
aaactagaggtaagggggagtctctattcaccataa-gactgtatgaacatatgggta |
39436065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 21494380 - 21494425
Alignment:
| Q |
19 |
attcaaccgtagaaattcatcaattcggcaaactagaggtaagggg |
64 |
Q |
| |
|
|||||| ||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
21494380 |
attcaatcgtaggaattcatgaattcgacaaactagaggtaagggg |
21494425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University