View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17632_high_23 (Length: 223)
Name: NF17632_high_23
Description: NF17632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17632_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 29 - 204
Target Start/End: Complemental strand, 7255500 - 7255326
Alignment:
| Q |
29 |
gatctttgtagttgtgcacaaataatacctactaaaaatattaatttatttgttatactatgctatatattcatctatttttggttcaatttgtaaggtt |
128 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7255500 |
gatctttgtagctgcgcacaaataatacctactaaaaatattaatttatttgttat-ctatgctataaattcatctatttttggttcaatttgtaaggtt |
7255402 |
T |
 |
| Q |
129 |
gatcactaatatgctacaagaacatgagtttaacttccccctccaacttaaaaacatctttgatagatgatcataa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7255401 |
gatcactaatatgctacaagaacatgagtttaacttccccctccaacttaaaaacatctttgatagatgatcataa |
7255326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University