View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17632_low_17 (Length: 256)
Name: NF17632_low_17
Description: NF17632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17632_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 33434152 - 33434375
Alignment:
| Q |
18 |
tctagtaattgtaatgattttatatacaattatttaagaattgcnnnnnnngcacagtgaacaagtcagtgtgtttatttttaattgaagtttcattgtg |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33434152 |
tctagtaattgtaatggttttatatacaattatttaagaattgcgaaaaaagcacagtgaacaagtcagtgtgtttatttttaattgaagtttcattgtg |
33434251 |
T |
|
| Q |
118 |
tattgaaagatatatagattgattgcatgaaaa-caatgcaaaaatttacgttagttagtgtgcagaatcatgaccaaatcatgaatttatcttctttaa |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33434252 |
tattgaaaaatatatagattgattgcatgaaaaacaatgcaaaaatttacgttagttagtgtgcagaatcatgaccaaatcatgaatttatcttctttaa |
33434351 |
T |
|
| Q |
217 |
tgtgctaaagatgtaagggttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33434352 |
tgtgctaaagatgtaagggttcat |
33434375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University