View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17632_low_18 (Length: 253)
Name: NF17632_low_18
Description: NF17632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17632_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 55245681 - 55245768
Alignment:
| Q |
1 |
cttcttcaagcttgaattagccagctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55245681 |
cttcttcaagcttgaattagccagctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt |
55245768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 157 - 246
Target Start/End: Original strand, 55245833 - 55245922
Alignment:
| Q |
157 |
gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgtgctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55245833 |
gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgggctc |
55245922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University