View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17633_high_23 (Length: 233)
Name: NF17633_high_23
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17633_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 15 - 136
Target Start/End: Complemental strand, 3734512 - 3734391
Alignment:
| Q |
15 |
caaaggcactgattgaaatacttgatgatgggtacagatggaggaagtatggaaagaaaatggttaagaatagccctaatccaaggtatatgtattggaa |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3734512 |
caaagtcactgattgaaatacttgatgatgggtacagatggaggaagtatggaaagaaaatggttaagaatagccctaatccaaggtatatatattggaa |
3734413 |
T |
|
| Q |
115 |
taccatgaaattaattgataac |
136 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3734412 |
taccatgaaattaattgataac |
3734391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 214
Target Start/End: Complemental strand, 3734348 - 3734317
Alignment:
| Q |
183 |
gtgattgcaggaattattataggtgttcagtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3734348 |
gtgattgcaggaattattataggtgttcagtg |
3734317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 102
Target Start/End: Complemental strand, 48289093 - 48289018
Alignment:
| Q |
27 |
ttgaaatacttgatgatgggtacagatggaggaagtatggaaagaaaatggttaagaatagccctaatccaaggta |
102 |
Q |
| |
|
||||||| || |||||||||| ||||||||||||||| |||||||| ||||| || || ||||| ||||||||||| |
|
|
| T |
48289093 |
ttgaaattctggatgatgggttcagatggaggaagtacggaaagaagatggtgaaaaacagccccaatccaaggta |
48289018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University