View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17633_high_25 (Length: 226)
Name: NF17633_high_25
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17633_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 206
Target Start/End: Complemental strand, 8266812 - 8266621
Alignment:
| Q |
15 |
aacctgtgaacacaaatctccccctcatttaagggcattgctcgcggagagactgactacaggcaacttgccacaggtcggcaatacatcagaatggaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8266812 |
aacctgtgaacacaaatctccccctcatttaagggcattgctcgcggagagactgactacaggcaacttgccacaggtcggcaatacatcagaatggaaa |
8266713 |
T |
 |
| Q |
115 |
ctaattaacactatgtctgctgttgttctaccacaaaaaggaatttatatggaacaagtgggaccacaattacatcaaattatcaatcttct |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8266712 |
ctaattaactctatgtctgctgttgttctaccacaaaaaggaatttatatggaacaagtgggaccacaattacatcaaattatcaatcttct |
8266621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University