View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17633_low_12 (Length: 358)
Name: NF17633_low_12
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17633_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 19 - 347
Target Start/End: Complemental strand, 37558908 - 37558580
Alignment:
| Q |
19 |
aagattgcagcagcagggagctaaggcttgaacttttgatatgtagagattctgtacattgttcacaaatgatcatagggtcgagtgatattctggtaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558908 |
aagattgcagcagcagggagctaaggcttgaacttttgatatgtagagattctgtacattgttcacaaatgatcatagggtcgagtgatattctggtaga |
37558809 |
T |
|
| Q |
119 |
actttctacaactgatttaaattttcattagattgtatgcagattttctattgttggctgatacaagagattttgattttgtgagatgataattcgcaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558808 |
actttctacaactgatttaaattttcagtagattgtatgcagattttctattgttggctgatacaagagattttgattttgtgagatgataattcgcaaa |
37558709 |
T |
|
| Q |
219 |
tggttattggcaatagcattattcttattgggtccaattttaaaacttacatgttcttattattgctatagtaagattattttacaggccttaaatttga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558708 |
tggttattggcaatagcattattcttatcgggtccaattttaaaacttacatgttcttattattgctatagtaagattattttacaggccttaaatttga |
37558609 |
T |
|
| Q |
319 |
catggcttcggaaggtttgattatatatt |
347 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37558608 |
catggcttcggaaggtttgattatatatt |
37558580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University