View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17633_low_13 (Length: 345)
Name: NF17633_low_13
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17633_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 39970179 - 39969845
Alignment:
| Q |
1 |
tgtttctaagcataattgtttcctagctaaaaaccacattgcacaaaaatcatgagtattt-tttcttgtgtttacattttggagcatggtaagatgata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39970179 |
tgtttctaagcataattgtttcctagctaaaaaccacattgcacaaaactcatgagtatttgttttttgtgtttacattttggagcatggtaagatgata |
39970080 |
T |
|
| Q |
100 |
aattcaggttccctataattggatcgacgtagtcatgagatttcatattcacacatttgatcggaccgccattgtcgtctcaaatgcctgaatgcaaacc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39970079 |
aattcaggttccctataattggatcgacgtagtcatgagatttcatattcacacatttgatcggaccgccattgttgtctcaaatgcctgaatgcaaacc |
39969980 |
T |
|
| Q |
200 |
ccctg----attgcagcgaatcaaaactcgatgatcactatttgagctttaaactttgacttggtccaatagaccatacctcatgcaaaaatattggcta |
295 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39969979 |
ccctgattgattgcagcgaatcaaaactcaatgatcactatttgagctttaaactttgacttcgtccaatagaccatacctcatgcaaaaatattggcta |
39969880 |
T |
|
| Q |
296 |
aaacaggacagtccgatgtttttaggcttggttga |
330 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
39969879 |
aaacgggacagtccgatgtttttaggcttggttga |
39969845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University