View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17633_low_22 (Length: 245)
Name: NF17633_low_22
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17633_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 52449368 - 52449582
Alignment:
| Q |
16 |
atctattactgcagcgaatccctcgtcaagcgtgccaccaacatcgctagacctaacctcgtttcactcggaacgtgtatcggaaaatacacacacggtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52449368 |
atctattactgcagcgaatccctcgtcaagcgtgccaccaacatcgctagacctaacctcgtttcactcggaacgtgtatcggaaaatacacacacggtg |
52449467 |
T |
 |
| Q |
116 |
gaaattttcatctcaccgttcaggcgctgaatttacttgctgcgaatgccaagcataaggtatggcttaaaccacaatctgagatgtcgtttttgtatgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52449468 |
gaaattttcatctcaccgttcaggcgctgaatttacttgctgcgaatgccaagcataaggtatggcttaaaccacaatctgagatgtcgtttttgtatgg |
52449567 |
T |
 |
| Q |
216 |
gaatcatgtgttgaa |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52449568 |
gaatcatgtgttgaa |
52449582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University