View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17633_low_23 (Length: 241)
Name: NF17633_low_23
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17633_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 230
Target Start/End: Original strand, 40180524 - 40180744
Alignment:
| Q |
10 |
ataatactatgaacttctatttacgagaatcaacatcaattatttttagagtttcaaaagattttcaaatattggttgagtgtaagccatataagatcat |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40180524 |
ataatactatgaacttcaatttacgagaaacaacatcaattatttttagagtttcaaaagattttcaaatattggtcgagtgtaagccatataagatcat |
40180623 |
T |
 |
| Q |
110 |
ttttccatcataatagtcatctaagatagtagagactttttgtctaatgtgcataagtataataatcttgcacaaacgaataagtctgtttcacatgatt |
209 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40180624 |
tttcctatcataatagtcatctaagatagtagagactttttgtctaatgtgcataagtaaaataatcttgcaaaaacgaataagtctgtttcacatgatt |
40180723 |
T |
 |
| Q |
210 |
agcttaacatgtctttttata |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40180724 |
agcttaacatgtctttttata |
40180744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University