View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17633_low_25 (Length: 233)
Name: NF17633_low_25
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17633_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 6267395 - 6267194
Alignment:
| Q |
17 |
atttctaactttccttacaaggctttccctaatcttaaaaataacaattttctattgctggttgttccaactgaactcgtaaaagcaaaaattaaagagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6267395 |
atttctaactttccttacaaggctttccctaatcttaaaaa---caattttctattgctggttgttccaactgaactcgtaaaagcaaaaattaaagagc |
6267299 |
T |
|
| Q |
117 |
ttctaccaaagaccaacataacaactaggttggtgaattggaaaagttgatagggatactagcaagtattaaatcttagagtcacatgtttagtacatag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6267298 |
ttctaccaaagaccaacataacaactaggttggtgaattggaaaagttgatagggatactagcaagtattaaatcttagagtcacatgtttagtacatag |
6267199 |
T |
|
| Q |
217 |
ttcat |
221 |
Q |
| |
|
||||| |
|
|
| T |
6267198 |
ttcat |
6267194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University