View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17633_low_26 (Length: 226)

Name: NF17633_low_26
Description: NF17633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17633_low_26
NF17633_low_26
[»] chr2 (1 HSPs)
chr2 (15-206)||(8266621-8266812)


Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 206
Target Start/End: Complemental strand, 8266812 - 8266621
Alignment:
15 aacctgtgaacacaaatctccccctcatttaagggcattgctcgcggagagactgactacaggcaacttgccacaggtcggcaatacatcagaatggaaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8266812 aacctgtgaacacaaatctccccctcatttaagggcattgctcgcggagagactgactacaggcaacttgccacaggtcggcaatacatcagaatggaaa 8266713  T
115 ctaattaacactatgtctgctgttgttctaccacaaaaaggaatttatatggaacaagtgggaccacaattacatcaaattatcaatcttct 206  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8266712 ctaattaactctatgtctgctgttgttctaccacaaaaaggaatttatatggaacaagtgggaccacaattacatcaaattatcaatcttct 8266621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University