View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_high_40 (Length: 290)
Name: NF17635_high_40
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_high_40 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 290
Target Start/End: Original strand, 29005770 - 29006044
Alignment:
| Q |
17 |
tccatctcttgcctgcaaaatgcctttaatttcaatttgaaaagtttagttctggacttctattttgaatattggcctaccatttctattttaacctaat |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29005770 |
tccatatcttgcctgcaaaatgcctttaatttcaatttgaaaagtttagttctggacttctattttgaatattggcctaccatttctattttaacctaat |
29005869 |
T |
|
| Q |
117 |
cttgctacttttgtctctgctactaagaaaatcaccatgtgcccatgtcttccatgaagcaccaaattagaaaagatacactcattcctcacttcccata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29005870 |
attgctacttttgtctctgctactaagaaaatcaccatgtgcctatgtcttccatgaagcaccaaattagaaaagatacactcattcctcacttcccata |
29005969 |
T |
|
| Q |
217 |
gagccactttcccaatgaggagtaaaatgag-nnnnnnnngattactagcataaccataggcacctccaaatacc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29005970 |
gagccactttcccaatgaggagtaaaatgagaaaaaaaaagattactagcataaccataggcacctccaaatacc |
29006044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University