View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_high_52 (Length: 243)
Name: NF17635_high_52
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 230
Target Start/End: Original strand, 2738574 - 2738784
Alignment:
| Q |
20 |
tctattgtctacaaggtagcttctatatgtttgataggggttttcaattcaaatacttgcaaactgcaatgttgtgttggcttcattatctccatctcca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2738574 |
tctattgtctacaaggtagcttctatatgtttgataggggttttcaattcaaatacttgcaaactgcaatgttgtgttggcttcattatctccatctcca |
2738673 |
T |
|
| Q |
120 |
taaatgtatcttcttctatgaaaattttatattgatgtttggtgattataatgtaatcatgatagttaggaataaaaatagaatcaatatcgctaaaaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2738674 |
taaatgtatcttcttctatgaaaattttatattgatgtttggtgattataatgtaatcatgatagttaggaataaaaatagaatcaatatcgctaaaaga |
2738773 |
T |
|
| Q |
220 |
aaagtataatc |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
2738774 |
aaagtataatc |
2738784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University