View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_high_53 (Length: 242)
Name: NF17635_high_53
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_high_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 22698388 - 22698611
Alignment:
| Q |
1 |
agtcaaatgtcgccaatgcgatctcaacca--gtcatgaagacgacaaaaaccttgatgtcgtagtcaagatcgtggttgtatagctttttcgaaactcg |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22698388 |
agtcaaatgtcgccaatgcgttctcaaccacagtcatgaagacgacaaaaaccttgatgtcgtagtcaagatcgtggttgtatagctttttcaaaactcg |
22698487 |
T |
|
| Q |
99 |
atcctaattaataatattatatttgtaatcagggttttaaacaaaggttgacgatagcgatctaagctgcagagtaacagttttttatgttaccaaaacc |
198 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22698488 |
atcctaat----aatattatatttgtaatcagggttttaaacaaaggttggcgatagcgatctaagccgcagagtaacagttttttatgttaccaaaacc |
22698583 |
T |
|
| Q |
199 |
ttaacatgacagcttttgaggccatatc |
226 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
22698584 |
ttaacatgacagcttttgaagccatatc |
22698611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 22687803 - 22687839
Alignment:
| Q |
30 |
agtcatgaagacgacaaaaaccttgatgtcgtagtca |
66 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
22687803 |
agtcgtgaagacaacaaaaaccttgatgtcgtagtca |
22687839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University