View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_high_56 (Length: 233)
Name: NF17635_high_56
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_high_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 29 - 221
Target Start/End: Complemental strand, 9540102 - 9539912
Alignment:
| Q |
29 |
tgatagtatgatttttatccatgttaggatttccccattaagttaatgtatgtgtttgtgcttgcactttctgctggaatatgtttttaagctatgagaa |
128 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| || |
|
|
| T |
9540102 |
tgatagtatgatttt-atccatgttaggatttccccattaagttaatgtatgtgtttgtgcttgcactttctgctagaatatatttttaagctatga-aa |
9540005 |
T |
 |
| Q |
129 |
tcggttactacaactgccatgcctcgaaaaactgtgtttttagcactgataaccgattacactaagtgtgcaaccggttgcacactaggaagt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9540004 |
tcggttactacaactgccatgcctcgaaaaactgtgtttttagcactgataaccgattacactaagtgtgcaaccggttgcacactaggaagt |
9539912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University