View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_high_58 (Length: 216)
Name: NF17635_high_58
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_high_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 11 - 202
Target Start/End: Complemental strand, 2307679 - 2307488
Alignment:
| Q |
11 |
gagcacagaacatgtattttgtttgcacttggcacattcaaccttataaatctgagaatgcttcaatgatcgagtttgtttatggccctttgcatgcatc |
110 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
2307679 |
gagcacagtacatgtattttgtttgcacttggcacattcaatcttataaatctaataatgcttcaatgatctagtttgtttacggccctttgcatgcatc |
2307580 |
T |
 |
| Q |
111 |
atgccaggaannnnnnnnaacgaaattagcattgatcagttgtatactgcatatttctgcagaagataggtgctgcaagtgcaattagatat |
202 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2307579 |
atgccaggaattttttttaacgaaattagcattgatcagttgtatactgcatatttctgcagaagataggtgctgcaagtgcaattagatat |
2307488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 23 - 185
Target Start/End: Complemental strand, 2316867 - 2316709
Alignment:
| Q |
23 |
tgtattttgtttgcacttggcacattcaaccttataaatctgagaatgcttcaatgatcgagtttgtttatggccctttgcatgcatcatgccaggaann |
122 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| | ||||||||||||||| |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
2316867 |
tgtattttgtttgcacttggcaaattcaatcttataaatctaataatgcttcaatgatctagtttgtttacggccctttgcatgcatcatgggaggaatt |
2316768 |
T |
 |
| Q |
123 |
nnnnnnaacgaaattagcattgatcagttgtatactgcatatttctgcagaagataggtgctg |
185 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
2316767 |
ttttttaacgaaattagc----agcagtggtatactgcatatttctgcagaagatagatgctg |
2316709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University