View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_high_59 (Length: 213)
Name: NF17635_high_59
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_high_59 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 2705237 - 2705415
Alignment:
| Q |
20 |
ttagaggataatgttgatgatgttttgtggtcctaggaaaagatgttcttctaaaaatttcttcaacttgatgattccttctaccttcatcacctttctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2705237 |
ttagaggataatgttgatgatgttttgtggtcctaggaaaagatgttcttctaaaaatttcttcaacttgatgattccttctaccttcatcacctttctt |
2705336 |
T |
 |
| Q |
120 |
ttcccctgaagctaaatgtgcaacaacaaaacaaaaacttgttccttcaatcaacatactaactccaacacaacctttg |
198 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2705337 |
ttcccccgaagctaaatgtgcaacaacaaaacaaaaacttgttccttcaatcaacatactaactccaacacaacctttg |
2705415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University