View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_high_60 (Length: 210)
Name: NF17635_high_60
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_high_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 34 - 189
Target Start/End: Complemental strand, 1058020 - 1057865
Alignment:
| Q |
34 |
tattataaagaagaaaataatcatatcatacatcattcattatcttctcaatggctgtttcttactcattcttgccactaagcttcttctttttcctctt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1058020 |
tattataaagaagaaaataatcatatcatacatcattcattctcttctcaatggctgtttcttactcattcttggcactaagcttcttctttttcctctt |
1057921 |
T |
|
| Q |
134 |
cacactctctccttttcctgtttctgctacagaccacattgtaggtgccaaccgtg |
189 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
1057920 |
cacactctctcctttacctgtttccgctactgaccacattgtaggtgccaaccgtg |
1057865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University