View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_low_17 (Length: 408)
Name: NF17635_low_17
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 18 - 392
Target Start/End: Complemental strand, 41116517 - 41116143
Alignment:
| Q |
18 |
gtgggaagtaacatgcttctttatgcttcatggggtgtgtgtagttgtggagattggtgtgaagaagtggttggatcataaatggagagtacactgggcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41116517 |
gtgggaagtaacatgcttctttatgcttcatggggtgtgtgtagttgtggagattggtgtgaagaagtggttggatcataaatggagagtacattgggcc |
41116418 |
T |
|
| Q |
118 |
atatctggtcccactacggtggtgtttgtggtgtccactgctgcatggctattctttccaccgttgttacgtgatggtgctgataagagaaccattgagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41116417 |
atatctggtcccactacggtggtgtttgtggtgtccactgctgcatggctattctttccaccgttgttacgtgatggtgctgatcagagaaccattgagg |
41116318 |
T |
|
| Q |
218 |
agttcaaattttttgattgtttagtgggaaagttttaggttgaacttgttttggagtcttttgagcaggcagggttttattttttggatatatgttgtct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41116317 |
agttcaaattttttgattgtttagtgggaatgttttaggttgaacttgttttggagtcttttgagcaggcagggttttattttttggatatatgttgtct |
41116218 |
T |
|
| Q |
318 |
cattggagcaatttaaagtctgcagaagctgttgatatttcagaggcattttctggttctgttgttgtttctctg |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41116217 |
cattggagcaatttaaagtctgcagaagctgttgatatttcagaggcattttctggttctgttgttgtttctctg |
41116143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University