View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_low_29 (Length: 361)
Name: NF17635_low_29
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 347
Target Start/End: Complemental strand, 3090432 - 3090085
Alignment:
| Q |
1 |
ttaaattgaatattaaaatgaagtttttctgtacaaaaaagaagttgtcactcaaatagtcaaatttgatcttgcaacctagtcaagaagagatagttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090432 |
ttaaattgaatattaaaatgaagtttttctgtacaaaaaagaagttgtcactcaaatagtcaaatttgatcttgcaacctagtcaagaagagatagttgc |
3090333 |
T |
|
| Q |
101 |
tggaccagttgagctacattgtcatcgtatagaattttcaactttcatatttaatatttgtaaaataaaattcgtttgaaggcctaaaagatctttagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3090332 |
tggaccagttgagctacattgtcatcgtatagaattttcaactttcatatttaatatttgtacagtaaaattcgtttggaggcctaaaagatctttagaa |
3090233 |
T |
|
| Q |
201 |
tttggaccgtcttatgcttggatcgaccctagatataaatataatataaccatgctactttgcttcttctttttttctcattaa-nnnnnnnnnngagag |
299 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3090232 |
tttggaccgtcttatgtttggatcgaccctagatataaatataatataaccatgctactttgcttcttctttttttctcattaatttttttttttgagag |
3090133 |
T |
|
| Q |
300 |
atttttctcattaattataagtaggatatttcgaagtggttccctttg |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090132 |
atttttctcattaattataagtaggatatttcgaagtggttccctttg |
3090085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University