View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_low_30 (Length: 357)
Name: NF17635_low_30
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 240
Target Start/End: Original strand, 1193126 - 1193349
Alignment:
| Q |
13 |
attctctccggttatttttagaataattatgatctgttttgtttggaaaatgaagagaaaggaaggaatattcattttacgttactaagagttaatcaac |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1193126 |
attctctccggttatttttagaatatttatggtctgttttgtttggaaaatgaagagaaaggaaggaatattcattttacgttactaagagttaatcaac |
1193225 |
T |
|
| Q |
113 |
taattaagctttctattactagttaattcatctattttatactaacttatttactacgtactagcatgttttgtcaaaatttgctaatcacttacttaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1193226 |
taattaagctttctattactagttaattcatctattttagactaacttatttac----tactagcatgttttgtcaaaatttggtaatcacttacttaaa |
1193321 |
T |
|
| Q |
213 |
atactttacactaaaagagcgagttgct |
240 |
Q |
| |
|
|||||| |||||| |||||||||||||| |
|
|
| T |
1193322 |
atacttaacactataagagcgagttgct |
1193349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University