View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17635_low_58 (Length: 230)
Name: NF17635_low_58
Description: NF17635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17635_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 55 - 216
Target Start/End: Original strand, 8894573 - 8894731
Alignment:
| Q |
55 |
ggacgaatacactattttatattaaattacatttcgttatcatcagttcaaaatcattcccaaatatgctccgacaagtctgtttgaagttggcgataat |
154 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8894573 |
ggacgaatacactat---atattaaattacattttgttatcatcagttcaaaatcattcccaaatatgctccaacaagtctgtttgaagttggcgataat |
8894669 |
T |
 |
| Q |
155 |
gtataaccatggctaacgcatccctcaccttaattgaatcatgtatatcatttagcttcatc |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8894670 |
gtataaccatggctaacgtatccctcaccttaattgaatcatgtataccatttagcttcatc |
8894731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University