View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17636_high_8 (Length: 310)
Name: NF17636_high_8
Description: NF17636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17636_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 25 - 297
Target Start/End: Complemental strand, 53414849 - 53414577
Alignment:
| Q |
25 |
atagttgttggttaatacaatggattggtatgctttctcattgttttctatcaaaactgagtaacaagagttctacctttgtttatcgaacccagcgacg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53414849 |
atagttgttggttaatacaatggattggtatgctttctcattgttttctatcaaaactgagtaacaagagttctacctttgtttatcgaacccagcgacg |
53414750 |
T |
|
| Q |
125 |
aggtcattgtcaatatctcccttaacttgaggacggttttgatgaagtgatgctatagtatgagtcttagaaaaagactcggtaataaaacgcagtatca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53414749 |
aggtcattgtcaatatctcccttaacttgaggacggttttgatgaagtgatgctatagtatgagtcttagaaaaagactcggtaataaaaggcagtatca |
53414650 |
T |
|
| Q |
225 |
taatgaaaaacaaaccatcggatgaacgaaacttttagctaagaaacaatacttgtttaaaccctttcttttc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53414649 |
taatgaaaaacaaaccatcggatgaacgaaacttttagctaagaaacaatacctgtttaaaccctttcttttc |
53414577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University