View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17636_high_9 (Length: 279)
Name: NF17636_high_9
Description: NF17636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17636_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 14 - 262
Target Start/End: Complemental strand, 37488275 - 37488027
Alignment:
| Q |
14 |
atattgaaagcatgcgtaagattaatgcagcattattatgttaccatagtgcgtgtgttaggttttgatggcacgtgatatgacctcaggctcaggcctc |
113 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37488275 |
atattgaaagcatgcataagattaatgcagcattattatgttaccatagtgcgtgtgttaggttttgatggcacgtgatatgacctcaggctcaggcctc |
37488176 |
T |
 |
| Q |
114 |
cttttccagaactgtgcctggaaagttgtaacaggacggcggttgggaggatcttgttcttttgcttgaaaggtaatataatacataccaccaggtctcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37488175 |
cttttccagaactgtgcctggaaagttgtaacaggacggcggttgggaggatcttgttcttttgcttgaaaggtaatataatacataccaccaggtctcc |
37488076 |
T |
 |
| Q |
214 |
aggttgtcttcacaatgtcagctaacacaaattttgcaccctaataatt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37488075 |
aggttgtcttcacaatgtcagctaacacaaattttgcaccctaataatt |
37488027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 176 - 257
Target Start/End: Complemental strand, 37493296 - 37493215
Alignment:
| Q |
176 |
tgcttgaaaggtaatataatacataccaccaggtctccaggttgtcttcacaatgtcagctaacacaaattttgcaccctaa |
257 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37493296 |
tgcttgaaaggtaatgtaatacgtacgaccaggtctccaggttgtcttcacaatgtcagcaaacacaaaatttgcaccctaa |
37493215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 101 - 174
Target Start/End: Complemental strand, 37494912 - 37494839
Alignment:
| Q |
101 |
aggctcaggcctccttttccagaactgtgcctggaaagttgtaacaggacggcggttgggaggatcttgttctt |
174 |
Q |
| |
|
||||||||||||| | || |||| |||||||||||| |||||||||| | || |||| ||||||||||||||| |
|
|
| T |
37494912 |
aggctcaggcctcttattgcagacttgtgcctggaaaattgtaacagggcagcagttgtgaggatcttgttctt |
37494839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 103
Target Start/End: Complemental strand, 38922731 - 38922682
Alignment:
| Q |
54 |
ttaccatagtgcgtgtgttaggttttgatggcacgtgatatgacctcagg |
103 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
38922731 |
ttaccatagtgagtgagttaggttttgatggcacgcgacttgacctcagg |
38922682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University