View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17637_low_10 (Length: 220)
Name: NF17637_low_10
Description: NF17637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17637_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 114 - 215
Target Start/End: Complemental strand, 8518864 - 8518763
Alignment:
| Q |
114 |
tgtcttatcgcatcatagaaactttaatgtatatgactaatgttattttaaacaaatatttcacagtaatgattagttttacatccaacaatatgcaact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8518864 |
tgtcttatcgcatcatagaaactttaatgtatatgactaatgttattttaaacaaatatttcacagtaatgattagttttacatccaacaatttgcaact |
8518765 |
T |
 |
| Q |
214 |
ca |
215 |
Q |
| |
|
|| |
|
|
| T |
8518764 |
ca |
8518763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 8518994 - 8518964
Alignment:
| Q |
1 |
ttcacatccactacacatgagtgatgagatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8518994 |
ttcacatccactacacatgagtgatgagatg |
8518964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University