View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17638_high_11 (Length: 378)
Name: NF17638_high_11
Description: NF17638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17638_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 138 - 368
Target Start/End: Original strand, 11023094 - 11023324
Alignment:
| Q |
138 |
cctacatgctagtgcggtgctttgtacgttttgctctcatccggggtacgtcttgtgcttggtcctgaaatttgtacaaccgacagaagctggcttagta |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11023094 |
cctacatgctagtgcggtgctttgtacgttttgctctcatccggggcacgtcttgtgcttggtcctgaaatttgtacaaccgacagaagctggcttagta |
11023193 |
T |
|
| Q |
238 |
attgttaatagtaccgtcatctgaaattgttaattcgggtcagcgttttatacatgttagtcgcaaaatatagattgactgattcttccttcgttgatca |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11023194 |
attgttaatagtaccgtcatctgaaattgttaattcgggtcagcgttttatacatgttagtcgcaaaatatagattgactgatgcttccttcgttgatca |
11023293 |
T |
|
| Q |
338 |
atttcccacactctcaagttcaccgcctttg |
368 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
11023294 |
atttcccacactctcaagttcaccacctttg |
11023324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 11022975 - 11023026
Alignment:
| Q |
19 |
gctttagcctcagctttgttcctcatttcatgttctctttctttaggttcca |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11022975 |
gctttagcctcagctttgttcctcatttcatgttctctttctttaggttcca |
11023026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 11008533 - 11008591
Alignment:
| Q |
138 |
cctacatgctagtgcggtgctttgtacgttttgctctcatccggggtacgtcttgtgctt |
197 |
Q |
| |
|
||||||||||||||| ||||| ||||| ||||||||| || |||||||||| |||||||| |
|
|
| T |
11008533 |
cctacatgctagtgcagtgctctgtacattttgctcttat-cggggtacgtgttgtgctt |
11008591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University