View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17638_low_11 (Length: 379)
Name: NF17638_low_11
Description: NF17638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17638_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 20 - 319
Target Start/End: Complemental strand, 10563783 - 10563485
Alignment:
| Q |
20 |
tttgtagtactccatcaaccacatggagatttgaccctccatctcaacaaaatagcattgtttcaacttcaaccatttctgctagaaaactttgtgccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10563783 |
tttgtagtactccatcaaccacatggagatttgaccctccatctcaacaaaatagcattgtttcaacttc---------tgctagaaaactttgtgccaa |
10563693 |
T |
 |
| Q |
120 |
cctttggcaaattcaacatacaccatttgccaaaatgaacaaacatggtggcactattcttcgccgccgccg---------ccaccaaagcactacttct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10563692 |
cctttggcaaattcaacatacaccatttgccaaaatgaacaaacatggtggcaccattcttcgccgccgccgccgtctccaccaccaaagcactacttct |
10563593 |
T |
 |
| Q |
211 |
gaccaggtttagtcttttgtttatgtgctgnnnnnnnnnnnnnnnnnnnngtaatatgtttctctgtgtgttaattgtttgttttgcactattaaacact |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10563592 |
gaccaggtttagtcttttgtttatgtgctg-ttttttatgttttttttttgtaatatgtttctctgtgtgttaattgtttgttttgcactattaaacact |
10563494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University