View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17638_low_26 (Length: 250)
Name: NF17638_low_26
Description: NF17638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17638_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 10092965 - 10092815
Alignment:
| Q |
1 |
ttctcagaatttcaattttcattatttcttttagatgttttgagtgatttttactatattgatctatcaagattcaacgtttctattgaatttaacaatt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10092965 |
ttctcagaatttcaattttcaatatttcttttagatgtt--gagtgatttttactatattgatctatcaagattcaacgtttctattgaatttaacaatt |
10092868 |
T |
 |
| Q |
101 |
ttttaataataaaagccatttgcgtcatcttagcccacactatgtagaagcta |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
10092867 |
ttttaataataaaagccatttgcgtcatcctagcccgcaccatgtagaagcta |
10092815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University